Springen naar inhoud

Startcodon rna sequentie


  • Log in om te kunnen reageren

#1

Thijs1988

    Thijs1988


  • 0 - 25 berichten
  • 5 berichten
  • Gebruiker

Geplaatst op 06 februari 2010 - 14:52

Hallo,

Ik had laatst een discussie met wat medestudenten. Het ging over het volgende. Stel we hebben een willekeurige sequentie:

AUCCUAUGUUCCACUAUGAAUUC enz.


Nu ging het over het vinden van het startcodon. Nu zei ik: We moeten gewoon zoeken naar AUG en daar begint het.
Dus het volgende:
AUCCU -AUG-UUC-CAC-UAU-GAA-UUC.
Hier zien we dus dat de start begint op positie 6.

Zij zeiden toen: Nee, je moet eerst de sequentie in stukjes van 3 en dan pas zoeken naar het startcodon.
Dus het volgende
AUC-CUA-UGU-UCC-ACU -AUG-AAU-UC enz.
Hier zien we dus dat de start begint op positie 16.

Wie van ons heeft dan gelijk?
Want zoals ik het zie, wordt er gewoon gezocht naar AUG en niet eerst in delen van 3.


gr. Thijs

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8247 berichten
  • VIP

Geplaatst op 06 februari 2010 - 15:07

Jij hebt gelijk, Het punt is dat het startcodon (in DNA ATG) AUG de bepalende plek is voor het begin van translatie. NIet alleen word hiermee het beginpunt van translatie bepaald ook bepaald dit de rest van de codons en dus het gehele reading frame.
"Meep meep meep." Beaker

#3

Bassie76

    Bassie76


  • 0 - 25 berichten
  • 11 berichten
  • Gebruiker

Geplaatst op 24 maart 2010 - 22:39

Hallo,

Ik had laatst een discussie met wat medestudenten. Het ging over het volgende. Stel we hebben een willekeurige sequentie:

AUCCUAUGUUCCACUAUGAAUUC enz.


Nu ging het over het vinden van het startcodon. Nu zei ik: We moeten gewoon zoeken naar AUG en daar begint het.
Dus het volgende:
AUCCU -AUG-UUC-CAC-UAU-GAA-UUC.
Hier zien we dus dat de start begint op positie 6.

Zij zeiden toen: Nee, je moet eerst de sequentie in stukjes van 3 en dan pas zoeken naar het startcodon.
Dus het volgende
AUC-CUA-UGU-UCC-ACU -AUG-AAU-UC enz.
Hier zien we dus dat de start begint op positie 16.

Wie van ons heeft dan gelijk?
Want zoals ik het zie, wordt er gewoon gezocht naar AUG en niet eerst in delen van 3.


gr. Thijs


Jij hebt gelijk en toch ook weer niet helemaal. Wat ik namelijk in de gegeven sequentie mis is een consensussequentie die belangrijk is voor de translatieinitiatie.
Voor eukaryoten is dit de Kozaksequentie: gcc (a/g)cc AUG g.
Voor prokaryoten is dat de Shine-Delgarnosequentie: agg agg die een aantal baseparen voor het startcodon ligt.
Feitelijk bevat het gegeven stukje DNA, naar mijn mening, dus geen startcodon.

#4

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8247 berichten
  • VIP

Geplaatst op 30 maart 2010 - 13:16

Feitelijk bevat het wel een startcodon (ATG/AUG), dit is echter niet de enige bepalende factor voor de daadwerlijke translatie.
"Meep meep meep." Beaker





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures