Springen naar inhoud

Translatie van mrna


  • Log in om te kunnen reageren

#1

anakin skywalker

    anakin skywalker


  • >100 berichten
  • 226 berichten
  • Ervaren gebruiker

Geplaatst op 20 mei 2010 - 17:30

Hieronder wordt een mRNA afgebeeld:

5’ 3’
UUUUACCACCGGAUGAUUCUUACAAUUAGAUGAACAGGUUGUAAA//An

In het coderend gen treden basensubstituties op. Deze mutaties zijn natuurlijk ook zichtbaar
in de hieronder afgebeelde mRNA sequentie:

5’ 3’
UUUUAACACCGGAUGAUUCUUACAAUUUGAUGAACAGGUUGUAAA//An

Rekening houdend met de genetische code zoals weergegeven in de tabel zal het eiwit na
translatie van het gewijzigde mRNA
<A> dezelfde lengte en dezelfde aminozuursequentie hebben als het oorspronkelijke eiwit.
<B> dezelfde maar een verschillende aminozuursequentie hebben als het oorspronkelijke
eiwit.
<C> één aminozuur korter zijn dan het oorspronkelijke eiwit.
<D> slechts twee aminozuren lang zijn.

UAA, UAG en UGA zijn stopcodons..

Het antwoord blijkt C te zijn...maar het aminozuur begint bij fenylalanine en komt daarna bij UAA, bij het gewijzigde mRNA....dan kan het antwoord toch niet C zijn want de translatie stopt al na 2 codons..??? ](*,) En ik dacht dat translatie van 5' naar 3' gebeurde?

Veranderd door anakin skywalker, 20 mei 2010 - 17:31


Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Paul0o

    Paul0o


  • >100 berichten
  • 111 berichten
  • Ervaren gebruiker

Geplaatst op 20 mei 2010 - 17:42

AUG is wel weer een startcodon...

#3

anakin skywalker

    anakin skywalker


  • >100 berichten
  • 226 berichten
  • Ervaren gebruiker

Geplaatst op 20 mei 2010 - 17:52

Maar horen die 2 stukken voor en na het startcodon dan bij elkaar? Bij een nieuw startcodon begint toch ook een nieuw eiwit? Of zijn die ketens enkel los van elkaar als er een stopcodon tussen zit?

#4

Mrtn

    Mrtn


  • >1k berichten
  • 4220 berichten
  • VIP

Geplaatst op 20 mei 2010 - 18:38

In-frame codeert AUG gewoon voor methionine en niet voor een nieuw eiwit. Evengoed, AUG als deel van een Kozak (consensus) sequence speelt inderdaad een grote rol in de initiatie van het translatieproces in eukrayoten.
De genoemde stop codons kloppen en ik neem aan dat vanaf helemaal links alles in-frame is (het klopt in tripletten van links tot rechts).
Verder gebeurt translatie is inderdaad van 5' naar 3' (van het mRNA) en ik moet helaas toegeven dat ik zo niet zie waarom het antwoord C moet zijn.
Of course, the theory of relativity only works if you're going west.
-Calvin-

#5

anakin skywalker

    anakin skywalker


  • >100 berichten
  • 226 berichten
  • Ervaren gebruiker

Geplaatst op 20 mei 2010 - 23:42

Ik heb het al ;)

Het 5e codon is een startcodon en een paar codons later stond er een stopcodon, niets vreemds tot daar, maar bij het gemuteerde deel is een base vervangen, waardoor het stopcodon 1 codon eerder komt, dus met verlies van 1 codon voor dat eiwit...als je even voorbij het 5e codon (het startcodon) kijkt, zie je 2 keer na elkaar UGA...daar is het verlies van 1 codon opgetreden ](*,)

Toch bedankt!

#6

Mrtn

    Mrtn


  • >1k berichten
  • 4220 berichten
  • VIP

Geplaatst op 21 mei 2010 - 09:38

5’ 3’
UUUUACCACCGGAUGAUUCUUACAAUUAGAUGAACAGGUUGUAAA//An

In het coderend gen treden basensubstituties op. Deze mutaties zijn natuurlijk ook zichtbaar
in de hieronder afgebeelde mRNA sequentie:

5’ 3’
UUUUAACACCGGAUGAUUCUUACAAUUUGAUGAACAGGUUGUAAA//An

Ja natuurlijk, stom dat ik daar overheen heb gekeken ](*,)
Niet vergeten dat je hier eigenlijk al bijna aan het eind van de translatie zit (3' einde / poly-A staart) dus die AUG die ik rood heb gemaakt is geen startcodon maar gewoon methionine.
Of course, the theory of relativity only works if you're going west.
-Calvin-





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures