Springen naar inhoud

Transcriptie en Translatie programma

  • Log in om te kunnen reageren




  • 0 - 25 berichten
  • 4 berichten
  • Ervaren gebruiker

Geplaatst op 18 mei 2005 - 22:00

Hallo beste chemici,

Ik zoek een progje dat het volgende kan:
Als je de basevolgorde van DNA invult (bijv: CGTAGCTAGCTAGTTCGATAAGCTAGA) dat het progje dan zo voor je uitrekent/ laat zien wat de volgorde van de aminozuren is in het eiwit waar dit deel DNA voor codeert.
Hopelijk kunnen jullie me helpen. 8-[

Groetjes Quaerens Geplaatste afbeelding

Veranderd door biochemiefreak, 19 mei 2005 - 11:17

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.




  • 0 - 25 berichten
  • 4 berichten
  • Ervaren gebruiker

Geplaatst op 18 mei 2005 - 22:14

Ben een beetje in de bonen, ik bedoel natuurlijk transcryptie en translatie. 8-[
Excusez moi. :D




  • 0 - 25 berichten
  • 4 berichten
  • Ervaren gebruiker

Geplaatst op 18 mei 2005 - 22:31

Laat maar zitten, voordat ik hier reageerde had ik al een tijdje gegoogled, maar dat leverde niks op. Nog wat doorgooglen leverde wel wat op. 8-[




  • >5k berichten
  • 6850 berichten
  • Moderator

Geplaatst op 19 mei 2005 - 04:24

Zet je het antwoord hier ook even neer?

Ten overvloede voeg ik nog even toe dat er regelmatig nog na de translatie wijzigingen worden uitgevoerd op een eiwit. De automatisch gegenereerde sequentie is dus niet altijd de hele waarheid.




  • >1k berichten
  • 2330 berichten
  • VIP

Geplaatst op 19 mei 2005 - 09:01

Ik weet zo ff geen proggramma die dit kan maar er zijn genoeg data bases op het web waarbij een een sequentie in kunt voeren waaruit je een eiwit kunt halen.
hier heb je een hulp middeltje
Denk nog ff aan een paar dingen.
Transcriptie wil zeggen DNA wordt opgezet in RNA hierbij worden de exons en de introns van elkaar gescheiden en wordt de T een U in de sequentieinformatie RNA.
extra informatie

Vooral de scheiding van introns en exons zijn essentieel voor de samenstelling van je eiwit.

MvG Ron

Veranderd door biochemiefreak, 19 mei 2005 - 09:02




  • 0 - 25 berichten
  • 4 berichten
  • Ervaren gebruiker

Geplaatst op 19 mei 2005 - 22:05

Dat linkje wat ik had is toch wat minder goed dan die die biochemiefreak geeft. Da's een erg goede moet ik zeggen, bedankt! Geplaatste afbeelding

Groetjes Quaerens Geplaatste afbeelding
die weer wat wijzer is

Veranderd door Quaerens, 19 mei 2005 - 22:05

0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures
