Springen naar inhoud

DNA


  • Log in om te kunnen reageren

#1

suzyronsmans

    suzyronsmans


  • >25 berichten
  • 63 berichten
  • Gebruiker

Geplaatst op 06 november 2005 - 00:28

Hallo iedereen,

Ik moet een PCR uitvoeren van verschillende STR loci. Er werden telkens vier mogelijke printerparen voorgesteld. Hieronder heb ik enkel de gegevens gezet voor CD4.

Naar het schijnt zou
-de tm van left en right primer dicht bij elkaar moeten liggen
-gc% niet hoger dan 65 mogen zijn
-any (slaat op de zelfcomplementariteit vd primer) mag niet te hoog zijn
-3' mag ook niet te hoog zijn
(Ik heb echter geen idee van wat er met 'niet te hoog' wordt bedoeld)
(zijn er nog andere regels waar ik op moet letten?)

Kan iemand mij helpen het meest geschikte primerpaar te kiezen en argumenteren waarom het dat ene paar is, en waarom dan niet voor de drie overige primerparen gekozen werd?


primerA
No mispriming library specified
Using 1-based sequence positions
WARNING: Left primer is unacceptable: Tm too low/High self complementarity/Long poly-X

OLIGO ---------start --- len--- tm ------- gc% ----- any -- 3' ----- seq
LEFT PRIMER 12582 -- 20 -- 51.75 -- 30.00 -- 11.00 -- 3.00 -- ttttccagtctgaaaaaagt
RIGHT PRIMER 13073 -- 20 -- 59.99 -- 50.00 -- 4.00 -- 3.00 gttgcagtgagccaagatca
SEQUENCE SIZE: 13133
INCLUDED REGION SIZE: 13133

PRODUCT SIZE: 492, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 1.00

Primer B
No mispriming library specified
Using 1-based sequence positions
OLIGO ---------- start --- len --- tm ----- gc% ---- any --- 3' ------seq
LEFT PRIMER 12667 ---- 20 -- 59.98 --- 55.00 --- 4.00 --- 0.00 ---cttgagcccaggaagttgag
RIGHT PRIMER 12833 --- 19 --- 60.13 ---- 52.63 ---- 5.00 ---0.00 ----gttggagtcgcaagctgaa
SEQUENCE SIZE: 13133
INCLUDED REGION SIZE: 13133

PRODUCT SIZE: 167, PAIR ANY COMPL: 4.00, PAIR 3' COMPL: 3.00

Primer CNo mispriming library specified
Using 1-based sequence positions
OLIGO -------- start --- len ---- tm ------- gc% ----- any --- 3'------ seq
LEFT PRIMER 12734 ---- 25 --- 60.31---- 40.00 --- 5.00 --- 3.00 ---- gagtgagaacctgtcttgaaaagaa
RIGHT PRIMER 13073 --- 20 ---- 59.99 ---- 50.00 --- 4.00 ---- 3.00 ----gttgcagtgagccaagatca
SEQUENCE SIZE: 13133
INCLUDED REGION SIZE: 13133

PRODUCT SIZE: 340, PAIR ANY COMPL: 5.00, PAIR 3' COMPL: 0.00

Primer DNo mispriming library specified
Using 1-based sequence positions
OLIGO ------ start --- len ---- tm ---- gc% ------- any --- 3'------ seq
LEFT PRIMER 1752 --- 20 --- 59.86 --- 50.00 ---- 3.00 ---- 0.00 ----acccacctgtcaaccaaaag
RIGHT PRIMER 1938 --- 21 --- 60.07 --- 42.86 ---- 3.00 ---- 1.00 ---cacacaaatagcaaagcagca
SEQUENCE SIZE: 13133
INCLUDED REGION SIZE: 13133

PRODUCT SIZE: 187, PAIR ANY COMPL: 3.00, PAIR 3' COMPL: 0.00


Dank bij voorbaat
peggy

Veranderd door Peggy, 06 november 2005 - 00:39


Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Gideon

    Gideon


  • Chemiefoum.nl erelid
  • 337 berichten
  • Ervaren gebruiker

Geplaatst op 06 november 2005 - 09:07

Het laatste wat je wilt is dat je primers aan elkaar hybridseren op de 3' uiteinde, dit geeft namelijk grote kans op primer dimeren.

Zo op het eerste gezicht zou ik dus voor paar D gaan. Die heeft een complementariteitsscore van 0 op de 3' uiteinde en de laagste 'any' complementariteit. Dit zou dus inhouden dat dit de meest efficiente primers zijn.

Ik zou even zoeken op een Tm calculator, waarin je kunt zien wat je GC% is en of je smelttemperaturen dichter bij elkaar liggen dan bij de andere primers.

#3

Roy van Heesbeen

    Roy van Heesbeen


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 22 december 2005 - 23:49

Bij primer a en c is het gc gehalte ook vrij laag, ik zorg meestal dat het boven de 50 ligt, ook zit bij a de melting temperatuur ver uit elkaar, dit gaat erg moeilijk worden bij je PCR, en hij heeft ook een lange reeks A's wat ook het anealen kan verstoren...





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures