Springen naar inhoud

housekeeping gene


  • Log in om te kunnen reageren

#1

rob123

    rob123


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 09 maart 2007 - 09:54

Beste mensen,

Ik ben bezig met het ontwerpen van primers voor een positieve controle pcr, welke ik draai met 5 verschillende bacterien. Deze primers wil ik ontwerpen voor een housekeeping gene die in alle 5 voorkomt. Ik ben al een tijd aan het zoeken, maar ik kan maar geen gen vinden. Kan iemand mij helpen.

Bedankt

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

biochemiefreak

    biochemiefreak


  • >1k berichten
  • 2330 berichten
  • VIP

Geplaatst op 09 maart 2007 - 10:51

Ik heb even wat meer informatie nodig. Welke bacterie stammen heb je? Dan kunnen we wat gerichter zoeken.

MvG Ron

#3

rob123

    rob123


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 09 maart 2007 - 11:34

Dit zijn de bacterien
MRSA
S. aureus
Legionella pneumophila
Klebsiella pneumoniae
Salmonella choleraesuis

#4

biochemiefreak

    biochemiefreak


  • >1k berichten
  • 2330 berichten
  • VIP

Geplaatst op 09 maart 2007 - 12:14

MRSA is S. Aureus die meticilline-resistent is. Het huishoudgen voor deze stam is pta .
pta FP: AGAAGCAATCATTGATGGCGA RP: ACCTGGCGCTTTTTTCTCAG

Legionella pneumophila gevonden huishoudgenen.
acn, asd, rpoB

Klebsiella pneumoniae gevonden huishoudgenen
gyrA, mdh

Salmonella choleraesuis gevonden huishoudgenen
CD47/IAP, CXCL10 and SCARB2


Ik kom nergens dezelfde huishoud genen tegen misschien kun je een paar testen op homogenesis.

MvG Ron

Veranderd door biochemiefreak, 09 maart 2007 - 12:57


#5

rob123

    rob123


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 09 maart 2007 - 12:19

Bedankt

Maar ik zoek eigenlijk 1 gen welke in alle 5 voorkomt zodat 1 primerset afdoende is.

#6

Roy van Heesbeen

    Roy van Heesbeen


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 09 maart 2007 - 13:26

Mag het alleen positief zijn voor deze bacterien?
Dan wordt het vrij lastig...
Zelf denk ik dat het niet eens mogelijk is...
Je zal dan je product moeten sequencen.

#7

rob123

    rob123


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 09 maart 2007 - 13:31

Nee, het hoeft niet alleen positief te zijn voor deze bacterien. Het gen mag ook in andere bacterien voorkomen. Als het maar in ieder geval in deze 5 voorkomt. Zodat aangetoond kan worden dat er opzich DNA in oplossing aanwezig is.

#8

Roy van Heesbeen

    Roy van Heesbeen


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 11 maart 2007 - 14:37

Voor identificatie van bacterien wordt altijd een deel van het rRNA gen gepakt.
Deze is voor elke soort anders maar kan wel met dezelfde primers worden geamplificceerd. Door het gevormde product te sequencen en te blasten kun je vervolgens de bacterie identificeren.

#9

rob123

    rob123


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 12 maart 2007 - 12:15

Voor de positieve controle is het niet nodig om bacterien te identificeren. Ik moet alleen een primerset hebben welke in alle 5 bacterien een stuk dna kan amplificeren, zodat ik kan aantonen dat er dna aanwezig is.

#10

Roy van Heesbeen

    Roy van Heesbeen


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 12 maart 2007 - 12:41

Tja, dat moet je denk ik toch zelf uitzoeken door primers te maken voor genen die bij elke bacterie aanwezig zijn, dit zullen er vast een hoop zijn, maar de sequentie kan toch verschillen per stam.
Ik weet zo gauw geen site oid waar je dit kan vinden.





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures