Springen naar inhoud

CHI primers


  • Log in om te kunnen reageren

#1

placebo

    placebo


  • >250 berichten
  • 660 berichten
  • Gebruiker

Geplaatst op 28 mei 2008 - 08:31

hoi,

ik heb de sequentie van het CHI gen en de sequentie van mijn FW en RV primer. Nu zit ik met het probleem dat ik deze op blast probeer te vergelijken met elkaar en ik er niet helemaal aan uit kom of ik nou de goeie primers heb. Kan iemand mij hierbij helpen. Ik moet uiteindelijk deze primer gaan toepassen op 2 arabidopsis thaliana varianten. Waarvan ik het RNA isoleer en dmv RT-PCR cDNA maak.
In mijn onderzoek gaat er gewerkt worden met planten die gemutageniseerd zijn in het gebied van de transcriptiefactor Myb. Lijn N9602/Myb12-KO waar Myb is "uitgeknocked‚ÄĚ, en lijn N9603/Myb12-OX waar CHI en F3H duidelijk zijn opgereguleerd vergeleken met Myb12-KO. Het "uitknocken"van Myb bij Myb12-KO, heeft effect op de transcriptie van CHS, F3H, FLS en CHI; hierdoor wordt er minder quercitine en kaempferol, geproduceerd.


Sequentie primers

FW GCCTCTTCAGCATAGC
RV CCTCCAGRGTCCGTTA

sequentie gen

cattgttgagtcggttggaatttcgattgata
ataatgttacagagcttttcttgattgtgttttt
ggggcctttggggttaagtagaagagaga
agggtaggtagcaatagttacgattacgag
tgttggatgtgtaagcacgtgtactttcgttttc
gtctctttttttatattttgattgggagatgcatt
gacaattggtggttgaagctttgagcccttaa
atatgcagagcacatagttaggataatttcaa
atattttctatcgttatctttcatattattgattttat
atattttggttatttgagataattatatgattatttt
agagtttatctaggtttttgaattatattataaat
aaattgagttttattataaataaatcaggttttct
tttgtattcagtattcagttgattgatcaataaaa
ttaaaaaaaaaaaaatagcttttcagaaaaag
tattctctaattcttactttcggaaaatcaaagaa
aaaatcaaagaatttcttacgttctctagtttcta
atattcagaaatcctagttttttgggtattctcaat
atcaacatatctctttcttttcttatctattaaagctt
ctacgacttcagcccttatttcaacaaatcgttttg
tgaattaaaaacaataattcaacttggttcacttt
ggttttgaacaattgtacttagatttggttgggttt
tcgtttaactatgttcattttagataaataaaaac
ttttaacactcttttatatttaataaaacgtttaata
taaatttatcatatctattatatgacttcgtttagttt
gagttatggttttgatttgtttgttccgtaatattaa
aactaatcgggttataaacacatttcaattcaatt
ttggatttgtcagttctgatgccgggaagtgggc
tattacatgggctattgaaccccaccatgaatgc
tctctagattttgggttccggttgttcctacactgg
gctgaagtataataaaatctaactgaatctgaa
atgaaatccatgtgagtttgtcactgaaaaaac
aaaaaacaaaaatggcaaaaaatttaataga
ctcgagggaacgaacgttgcccaaaaaaaaa
agcaaaaaaaactagagaaaaaaaagtttta
aaatgctccacactttcttaattcttcatatatatat
atatttactttgagtaaaccatttaagatcatctaa
tatttaaatgaaaaatatttaatggaaaagtttat
agaagggccctttaatcagtgtgaaagcataaa
tggtttacagtttgaaagcataaattttcggtttgc
aaattttatggcttcaatttaactgcgcatttaaat
actttaaatgtattgtcgatttatatacataagtag
ttcgaaattaaacgtctactgtgatatgtttgaact
ttattcatttaatagtcattattgcaaaatcaacctc
taccaaatttaaaagtaaattaattatttactttgt
agtttagtgaatacattaatatcacattatataag
tcacaagattttgaattgtcccaaattatataaaa
ctttgaatcatttaactttaaattttctaacatctgtg
ccatgtttattgcagtagccaatctttttacacctca
gataaccagatttttttgatcatttactctctaccaa
aatgttctaatgttccatacatatagacaataattt
taaaactatttttcatatcctaattctccatgtatctt
gatttgtccatttttgatcttctaattttctcatcaaaa
tgacttgcgcatcaaaattcaattataaggacact
aatttcaaatgtgtattcaattggttcgaatttaattgt
gttctgacatgcatgttttaaattttgagtcattgaat
agtgagtaatgtctatcacaccagaaaatattata
tctcaaatttaggtgaatacattaattcactagatttt
cacttgtccattttttttctttgagtaaaatatactata
tatgaagtatgaagtatgaagtaagggagtccgg
accataaaacttatatctccaacgtgggatgcgca
atattcatttcatatctactaaacttcgtggttgaact
tttgttgatattttattttgctgaccattgtggaaaag
aactatcaccaatacttgaatattgatataactatat
ggttgaaaaattcgcaaaacattcaacagcagcc
cctagattttaattttttgaactgcacccaaagggac
aagacagcaaacaaaggagagcaacactacga
aacagaactatcaccaataggcaataagtaagg
aaaacgaaacagaaaaacagaggccaagtcaa
gacaaaggaacgagcagatagcgaaaccttga
aggagggtaatggtcttgctttacttaagcaattgtt
ctgcctcgaaatttaaatgtgtattcaagtaatcag
atgctaatttggatatttaagaagaaatacttgttta
ttttacagtatattcttttaaagaaacaaagatgaa
atgagtataaattttacaacttcttcacaaatgtata
gtaacatcgagaagctaattcttcaagcttcactta
aatatgtagctaatgcgcacaaatgtatttgtggg
cgctagtaagtagtaacctcacgtcctctta

Veranderd door Placebo, 28 mei 2008 - 10:05


Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Roy van Heesbeen

    Roy van Heesbeen


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 28 mei 2008 - 12:20

Ze annealen niet op je gen idd, heb je gekeken of de sites niet buiten je gen liggen?
De eerste 100 bp van een sequentie analyse zijn vaak niet betrouwbaar, dus als ik sequence primers ontwerp, leg ik die altijd +/- 100 bp weg vanaf het punt waar ik moet beginnen.

#3

placebo

    placebo


  • >250 berichten
  • 660 berichten
  • Gebruiker

Geplaatst op 29 mei 2008 - 11:53

ik heb de primers alleen nog bekeken met deze sequentie. ik kreeg het niet voor elkaar om de sequentie van arabidopsis thaliana te achterhalen. nu kun je via blast wel gelijk hierop blasten alleen kreeg ik hier geen resultaat mee.

#4

placebo

    placebo


  • >250 berichten
  • 660 berichten
  • Gebruiker

Geplaatst op 29 mei 2008 - 14:53

ik ben er al uit mijn lerares heeft me geholpen dit waren de verkeerde primers maar ze hadden dit nog niet gemeld. toch bedankt voor de hulp.





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures