Springen naar inhoud

BLAST


  • Log in om te kunnen reageren

#1

PlayboybunnieJ

    PlayboybunnieJ


  • 0 - 25 berichten
  • 21 berichten
  • Ervaren gebruiker

Geplaatst op 19 april 2009 - 13:55

Hoi!

Ik heb een onderzoek uitgevoerd. Nu waren alle gegevens in principe gegeven. Nu wil ik graag alsnog het volgende achterhalen: Ik zou graag mijn primers en mijn DNA-sequenties blasten.

Primers:
Primers voor Amel XY:
AmelPigFW 5" CRCMTTCATTGAYAATTCAC
AmelPigRV 5" CCAGAGGTTGTAACCTTACAG

Primers voor Male specific Pig:
MalePigFW 5" AAGTGGTCAGCGTGTCCATA
MalePigRV 5" TTTCTCCTGTATCCTCCTGC

Verder heb ik eigenlijk weinig tot geen gegevens. Er is gebruik gemaakt van varkenssperma. Ik zou graag willen weten op welke sequentie er gekeken is, maar ik weet niet hoe ik hier achter moet komen. (Ja door middel van ncbi, maar dan..?) Ik heb al gezocht op pig sperm, en daar kreeg ik wel een sequentie uit, maar ik weet niet welke gegevens je hiervan moet gebruiken om in te voeren in blast. Ook heb ik geen idee of dit eigenlijk wel de goeie sequentie is, aangezien daar verder weinig tot niets over bekend is. Ik heb de sequentie samen met alle 4 de primers (geen idee of ik ze alle 4 moest pakken o 1 of 3 of 2.. dus ik heb maar wat geprobeerd) ingevoerd in blast, primers beneden, sequentie boven en laten runnen, maar daar kwam niks uit.

Iemand die me hiermee iets verder op weg zou kunnen helpen??

De sequetie gevonden bij ncbi:
ORIGIN
1 gaattccggg tggaagtacc tgttctccgc aggcgctatg tggttgcggc cgtccatctg
61 gctctgcttt ccgctgtgtc ttgctctgcc aggccagtct cagcccaaag cagcagatga
121 ccttggtggc ctctactgtg ggccaagcag ctttcatttc tccataaatc ttctcagcca
181 ggacacagca actcctcctg cactggtggt ttgggacagg cgcgggcggc tgcacaagct
241 gcagaatgac tctggctgtg gcacgtgggt ccacaagggc ccaggcagct ccatgggagt
301 ggaagcatcc tacagaggct gctatgtgac tgagtgggac tctcactacc tcatgcccat
361 tggacttgaa gaagcagatg caggtggaca cagaacagtc acagagacga aactgtttaa
421 gtgccctgtg gatttcctag ctcttgatgt tccaaccatt ggcctttgtg atgctgtccc
481 agtgtgggac cgattgccat gtgctcctcc acccatcact caaggagaat gcaagcagct
541 tggctgctgc tacaactcgg aagaggtccc ttcttgttac tatggaaaca cagtgacctc
601 acgctgtacc caagatggcc acttctccat cgctgtgtct cgcaatgtga cctcacctcc
661 actgctctgg gattctgtgc acctggcctt cagaaatgac agtgaatgta aacctgtgat
721 ggaaacacac acttttgtcc tcttccggtt tccatttagt tcctgtggga ctgcaaaacg
781 ggtaactggg aaccaggcgg tatatgaaaa tgagctggta gcagctcggg atgtgaggac
841 ttggagccat ggttctatta cccgagacag catcttcagg cttcgagtca gttgtatcta
901 ctctgtaagt agcagtgctc tcccagttaa catccaggtt ttcactctcc caccaccgct
961 tccggagacc caccctggac ctcttactct ggagcttcag attgccaaag atgaacgcta
1021 tggctcctac tacaatgcta gtgactaccc ggtggtgaaa ttgcttcggg agcccatcta
1081 tgtggaggtc tctatccgtc accgaacaga ccccagtctc gggctgcacc tgcaccagtg
1141 ctgggccaca cccggcatga gccccctgct ccagccacag tggcccatgc tagtcaatgg
1201 atgcccctac actggagaca actaccagac caaactgatc cctgtccaga aagcctcaaa
1261 cctgctattt ccttctcact accagcgttt cagtgtttcc accttcagtt ttgtggactc
1321 tgtggcaaag caggcactca agggaccggt gtatctgcat tgtactgcat cggtctgcaa
1381 gcctgcaggg gcaccgatct gtgtgacaac ctgtcctgct gccagacgaa gaagaagttc
1441 tgacatccat tttcagaatg gcactgctag catttctagc aagggtccca tgattctact
1501 ccaagccact cgggactctt cagaaaggct ccataaatac tcaaggcctc ctgtagactc
1561 ccatgctctg tgggtggctg gcctcttggg aagcttaatt attggagcct tgttagtgtc
1621 ctacctggtc ttcaggaaat ggagatgagt tactcagacc aaatgtgtca ataaaaccaa
1681 taaaacaaaa ccggaattc

Bovenstaande sequentie NCBI

Alvast bedankt..

Met vriendelijke groet, Kelly.

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

rwwh

    rwwh


  • >5k berichten
  • 6847 berichten
  • Moderator

Geplaatst op 19 april 2009 - 17:31

Deze sequentie is natuurlijk niet het hele "pig sperm" DNA. Ik zou me kunnen voorstellen dat er geen hit is.

Zou je niet het complement van de primer tegen de hele sequence database kunnen blasten?

#3

PlayboybunnieJ

    PlayboybunnieJ


  • 0 - 25 berichten
  • 21 berichten
  • Ervaren gebruiker

Geplaatst op 19 april 2009 - 18:40

Haha
Dat had ik mezelf dus ook al afgevraagd.. Ik heb alleen totaal geen ervaring met blast (heb het 1 keer gebruikt/uitgevoerd) dus ik wist niet of dit een reeel beeld zou geven.. Je krijgt wel het target DNA dan, maar niet wat er voor of na komt.. Geen idee ook of dit verder nog nodig is, maar het is wellicht een idee om te doen wat je zei..
Ik ga het even proberen. Alvast bedankt!

Iemand anders nog andere ideeen?

Alvast bedankt!





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures