Springen naar inhoud

[scheikunde] Berekening Primer concentraties


  • Log in om te kunnen reageren

#1

Dutchie86

    Dutchie86


  • >25 berichten
  • 68 berichten
  • Ervaren gebruiker

Geplaatst op 06 februari 2010 - 12:21

Het volgende doet zich voor:

Ik heb een primer gebruikt (AGCCTGCCTACCACAGAGAA) met als concentratie 1566 ng/ul (gemeten met nanodrop). Deze primer heb ik 10x verdund dus de werkconcentratie is 156,6 ng/ul. Van deze werkconcentratie heb ik 1 ul gebruikt in een PCR reactie van totaal 50 ul. Wat is nu eind primer concentratie in umol/L?

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Fuzzwood

    Fuzzwood


  • >5k berichten
  • 11101 berichten
  • Moderator

Geplaatst op 06 februari 2010 - 14:01

Ok in die μl (microliter, dus "mu" geen "u") zit 156,6 ng primer. Die los jij op in een eindvolume van 50 μl. In een liter zou dan 20000x zoveel primer zitten, dus 3132000 ng, ofwel 3132 μg. Met de molmassa van je primer moet het nu een koud kunstje zijn dat gewicht om te rekenen.





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures