Springen naar inhoud

primer design

  • Log in om te kunnen reageren




  • 0 - 25 berichten
  • 11 berichten
  • Ervaren gebruiker

Geplaatst op 11 mei 2010 - 12:35

hallo mensen,

ik moet een forward en een reversed primer ontwikkelen voor de onderstaande sequentie.. ik heb een idee wat de forward primer moet zijn, dat begint namelijk met ATG.. (18-20 nucleotides lang), gewoon het begin van gepubliceerde sequentie, maar ik heb geen idee hoe ik de reversed primer moet ontwikkelen,

zou iemand mij hiermee kunnen helpen?


Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.




  • >5k berichten
  • 11112 berichten
  • Moderator

Geplaatst op 11 mei 2010 - 13:56

Stomme vraag/antwoord van een leek. Wordt dat niet gewoon de complementaire string?


Roy van Heesbeen

    Roy van Heesbeen

  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 11 mei 2010 - 14:42

AGCAGTCCACAGCAGTCTGA dit zijn de laatste 20 bp.
Deze maak je reverse complementair, dan kom je uit op:





  • >250 berichten
  • 723 berichten
  • Ervaren gebruiker

Geplaatst op 11 mei 2010 - 16:22

Raadpleeg eens een databank voor primer design (weet nietmeer hoe ze noemen.. Maar via pubmed kom je er wel. Je weet immers niet of je naar een unieke sequentie aan het zoeken bent en als dat niet is amplificeer je mss het verkeerde gen...




  • >25 berichten
  • 83 berichten
  • Ervaren gebruiker

Geplaatst op 12 mei 2010 - 09:11

Ik plaats hier even de link die Ronnie probeert te vinden.
Ik gebruik deze namelijk ook altijd.
Deze is makkelijk te bebruiken.


0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!
