Springen naar inhoud

primer ontwerp

  • Log in om te kunnen reageren




  • 0 - 25 berichten
  • 1 berichten
  • Ervaren gebruiker

Geplaatst op 13 januari 2011 - 21:31

Hallo allemaal,

Voor school moet ik een paar primers ontwerpen. Ben wel bekend met de regels, maar probeer het via een site maar krijg de hele tijd een melding dat ik iets niet goed heb ingevuld. Weet ook niet wat :oops:

Het moet via de volgende site http://frodo.wi.mit....imer3/input.htm

met deze sequentie:


Iemand enig idee wat ik aan de instellingen moet veranderen?

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.




  • >250 berichten
  • 723 berichten
  • Ervaren gebruiker

Geplaatst op 14 januari 2011 - 14:35

Is dat de sequentie van hetgeen je laten annealen met je primer?




  • >25 berichten
  • 86 berichten
  • Ervaren gebruiker

Geplaatst op 16 januari 2011 - 02:16

Primer 3 is een veelgebruikt webprogramma voor primer design. Het programma berekent primers aan de hand van optimale condities voor het smeltpunt van de primer, het 3"-einde smeltpunt van de primer, de lengte van de primer, de GC content, de complexiteit en de efficiëntie.

Ik neem aan dat CGTATATTCACATTTAATGAAGCAATAAAAAAGATATCCAAAATATCTACATCTCTGTGAC de minimale sequentie is die je moet amplificeren uit een groter DNA molecuul. Daarvoor heb je een forward primer (=left primer in Primer 3) en een reverse primer (=right primer in Primer 3) nodig. Probeer deze eerst afzonderlijk aan en uit te vinken in het programma. De reden waarom je een foutmelding krijgt is dat het programma geen optimale reverse primer kan geven voor een primer in deze sequentie (ook de forward primer is ver van optimaal met een lengte van 25bp, een lage efficientie van 78%, een veel te lage GC content, en een laag smeltpunt.). Je zal verder naar links en rechts in het grotere DNA molecuul moeten kijken om goede primers te vinden.

0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures
