Springen naar inhoud

Chromosoom(chromatine-genen


  • Log in om te kunnen reageren

#1

Buck

    Buck


  • 0 - 25 berichten
  • 5 berichten
  • Gebruiker

Geplaatst op 22 augustus 2006 - 08:37

Ik heb gelezen dat:
* slechts 20-30% van het DNA voor genen codeert
* chromosomen de stabiele dragers zijn van genen

Waar zit het 70-80% overige DNA. tss de lussen op het eiwitskelet van het chromosoom komen centromeren en telomeren voor, dus daar moet al een deeltje zitten. Het overige? Gewoon als losse fragmenten in de kern?

Thanx

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

WendyTje

    WendyTje


  • >250 berichten
  • 773 berichten
  • Ervaren gebruiker

Geplaatst op 22 augustus 2006 - 08:57

DNA hangt niet als losse stukjes in de cel, het bestaat uit chromosomen, lange strengen DNA met daarop de coderende stukken (genen)

De rest (waaronder ook introns) zit tussen de genen, heeft allerlei functies, onder andere structureel. Het word ook wel junk DNA genoemd, hoewel de laatste tijd steeds meer blijkt dat dit een nogal ongelukkig gekozen naam is omdat het waarschijnlijk zeer belangrijk is. Het hangt dus niet los in de cel, maar is gewoon een deel van de chromosomen, alleen codeert het (vooral en waarschijnlijk) niet.

Ook de chromosomen hangen niet los in de celkern, maar zitten weer gewikkeld in een constructie met histonen; chromatine. Dit heeft een "losser, meer actief" deel: euchromatine en een "dicht verpakt, minder actief" deel: hetrochromatine.

Er stond vorige week een leuk stuk over junk DNA in het NRC, maar dat kan ik nu niet meer online vinden (ging grappig genoeg ook over mijn baas en zijn/mijn onderzoek)
Wat links:
Wiki over chromosomen algemeen: http://nl.wikipedia....wiki/Chromosoom
Over junk: http://nl.wikipedia.org/wiki/Junk-DNA
Ook handig om gewoon te zoeken op chromatine, hoe dat nou in elkaar zit.
http://www.portfolio...3/chromatin.htm

Wordt het plaatje al wat duidelijker voor je?

#3

Dalton

    Dalton


  • >250 berichten
  • 808 berichten
  • Ervaren gebruiker

Geplaatst op 22 augustus 2006 - 16:08

Waar zit het 70-80% overige DNA.  tss de lussen op het eiwitskelet van het chromosoom komen centromeren en telomeren voor, dus daar moet al een deeltje zitten. Het overige? Gewoon als losse fragmenten in de kern?


Zoals WendyTje al zei is het DNA 1 lange streng per chromosoom.
Het ziet er bijvoorbeeld zo uit:
GCGATGGCTAGCTCGATCGATTTACCGGGGAATTTGCGATCGATGCTAGCT

De blauwe letters stellen 1 gen voor, als dit afgelezen wordt, dan worden de zwarte letters (het junk DNA) ertussen uit geknipt en krijg je dit:
GGCTAGTTACCG

PS: Een gen bestaat natuurlijk uit veel meer letters dan deze paar.

#4

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8252 berichten
  • VIP

Geplaatst op 22 augustus 2006 - 16:42

GGCTAGTTACCG


Dit noemt men het coderende DNA. Dit vind je in een humane cel niet als dusdanig terug. Het DNA wordt afgelezen en alleen het coderende DNA wordt omgezet in RNA. Dit RNA is wel weer om te zetten in DNA via reverse transcriptase, echter dit enzym komt niet in humane cellen voor.
"Meep meep meep." Beaker

#5

Bartsel

    Bartsel


  • >100 berichten
  • 196 berichten
  • Ervaren gebruiker

Geplaatst op 22 augustus 2006 - 17:16

Dit noemt men het coderende DNA. Dit vind je in een humane cel niet als dusdanig terug. Het DNA wordt afgelezen en alleen het coderende DNA wordt omgezet in RNA. Dit RNA is wel weer om te zetten in DNA via reverse transcriptase, echter dit enzym komt niet in humane cellen voor.


Volgens mij wordt wel het hele gen overgeschreven in een lange streng RNA, waar de intronen (=junk) later worden uitgeknipt ("gespliced"). Of beter gezegd: de exonen in het stuk messenger-RNA koppelen zich aan elkaar. De hierbij vrijkomende stukken "junk-RNA" worden afgebroken en gerecycled. An apparent waste.

Hoe dan ook, dit proces kan gemedieerd worden door eiwitten, maar ook door het RNA zelf of door ander RNA. De ontdekking van deze zelfveranderende (autokatalytische) eigenschap van RNA heeft ervoor gezorgd dat RNA wordt gezien als goede kanshebber om het eerste levende molecuul op de evolutionaire schaal te zijn geweest. DNA kan dit nl niet, hetgeen eerder leidde tot een jarenlange DNA-of-eiwitten-achtige kip-of-ei kwestie.

http://en.wikipedia....cing_(genetics)
"Pfff... Facts. You can prove anything with facts" -
Homer Simpson

#6

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8252 berichten
  • VIP

Geplaatst op 22 augustus 2006 - 17:34

Je hebt gelijk. DNA wordt omgezet in RNA. Dit RNA wordt gespliced door spliceosomen. Wat dan overblijft heet mRNA. Dit bevat alleen het coderende gedeelte.
"Meep meep meep." Beaker

#7

Dalton

    Dalton


  • >250 berichten
  • 808 berichten
  • Ervaren gebruiker

Geplaatst op 22 augustus 2006 - 20:52

Klopt, maar voor de vraagsteller leek het me beter om het simpel te houden.
Voor iemand die zich afvraagt waar het DNA zit lijkt het me een beetje overbodig om over splicing te beginnen.

#8

Bartsel

    Bartsel


  • >100 berichten
  • 196 berichten
  • Ervaren gebruiker

Geplaatst op 22 augustus 2006 - 22:22

Mee eens en goed gedaan m.i.
Maar we leren zo graag ;-)
"Pfff... Facts. You can prove anything with facts" -
Homer Simpson

#9

WendyTje

    WendyTje


  • >250 berichten
  • 773 berichten
  • Ervaren gebruiker

Geplaatst op 23 augustus 2006 - 13:36

Klopt, maar voor de vraagsteller leek het me beter om het simpel te houden.
Voor iemand die zich afvraagt waar het DNA zit lijkt het me een beetje overbodig om over splicing te beginnen.

Mijn idee! Ik had ook wel een paginalange post kunnen maken met hoe dat dan weer allemaal in elkaar zit, maar (afgezien dat ik misschien helemaal geen zin heb in in 1 keer lamme vingers van het typewerk) leek het me beter zo simpel mogelijk te beginnen. Ik zit al een tijdje in t vak en ik moet ook af en toe nog ff nadenken: Hoe zat dat hele reeksje van de transcriptie ed ook al weer precies? Lijkt me niet handig om daar meteen mee te beginnen, haak je volgens mij nogal snel af.
Niettemin hulde natuurlijk voor de pogingen het verhaal zo compleet mogelijk te maken! (maar in dat geval zijn we er nog lang niet... whos next?)

eneee aan de topic opener: Lees je dit nog? Snap je t al beter? Heb je nog vragen? Zou zonde zijn dat we hier massaal aan het denken en typen slaan terwijl je er niet meer naar kijkt natuurlijk.





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures