Springen naar inhoud

[Biologie] - DNA, mRNA, RNA Translation


  • Log in om te kunnen reageren

#1

Albert_Einstein

    Albert_Einstein


  • 0 - 25 berichten
  • 7 berichten
  • Gebruiker

Geplaatst op 25 januari 2007 - 19:57

Hallo iedereen,

k heb binnenkort een test over DNA, mRNA, RNA, maar hierover heb ik nog wat info nodig.

Ik moet dan bijv. van DNA: TACAAACATTTAGTTGTAAACACACCCTCAGTGGACCAACTCCGC
dit transcribe in de base sequence naar RNA.

Daarna moet ik de mRNA splitsen in de codon triplets.
Hiervan moet ik dan nog de amino acid (AA) boven elke mRNA codon zetten.

Hier snap ik gedeeltelijk niks van. Ben een tijdje ziek geweest en heb de helft van dit blok gemist... Graag zou ik hierover meer te weten willen komen.

Alvast bedankt!

Greetz Albert E.


http://www.wetenscha...showtopic=53108 Opgelost!


Edit mod Mrtn: stortvloed aan opmaak uit de tekst gehaald. We gaan voor een rustige uitstraling, gelieve daar een beetje meer aan mee te doen [rr]
E=MC²

Gruß, Albert E.

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

John Nash

    John Nash


  • >250 berichten
  • 536 berichten
  • Ervaren gebruiker

Geplaatst op 25 januari 2007 - 20:18

Ik was altijd ontzettend slecht in dat soort biologie onderwerpen. Ik sloeg dit altijd over, met lelijke cijfers als gevolg (toch biologie gehaald).

Maar goed, alles wat je gevraagd kan worden staat vast in je boek. Dus.

#3

Albert_Einstein

    Albert_Einstein


  • 0 - 25 berichten
  • 7 berichten
  • Gebruiker

Geplaatst op 25 januari 2007 - 20:23

Ja das dus een probleem...

Voor deze lessen gebruikten we geen boeken maar kopiëerbladen. Ook werd er een heleboel uitgelegd in de klas, dus over die info heb ik niets om van te leren...

(was ziek zoals ik al verteld had)
E=MC²

Gruß, Albert E.

#4

John Nash

    John Nash


  • >250 berichten
  • 536 berichten
  • Ervaren gebruiker

Geplaatst op 25 januari 2007 - 20:28

Oh oke. Al gegoogle'd?
Hier had mijn leraar het altijd over :) [rr] : http://www.bioplek.o...ite/zoeken.html

#5

Albert_Einstein

    Albert_Einstein


  • 0 - 25 berichten
  • 7 berichten
  • Gebruiker

Geplaatst op 25 januari 2007 - 20:40

Oh oke. Al gegoogle'd?
Hier had mijn leraar het altijd over  :)  [rr] :http://www.bioplek.org/site/zoeken.html

°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°°

Ja, heb deze site gevonden:

- http://web.jjay.cuny.../NSC/12-dna.htm

Is ongeveer wat ik zocht, en bedankt voor je informatie!!!

See ya next time!
E=MC²

Gruß, Albert E.

#6

Mrtn

    Mrtn


  • >1k berichten
  • 4220 berichten
  • VIP

Geplaatst op 26 januari 2007 - 07:52

Crossposten is niet toegestaan. Plaats huiswerk voortaan niet meer (ook) in biologie alsjeblieft. Lees de regels eens door alsjeblieft.
Of course, the theory of relativity only works if you're going west.
-Calvin-

#7

Albert_Einstein

    Albert_Einstein


  • 0 - 25 berichten
  • 7 berichten
  • Gebruiker

Geplaatst op 28 januari 2007 - 13:15

Crossposten is niet toegestaan. Plaats huiswerk voortaan niet meer (ook) in biologie alsjeblieft. Lees de regels eens door alsjeblieft.

Al gedaan, was een foutje sorry... :)
E=MC²

Gruß, Albert E.





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures