Springen naar inhoud

Dna en rna


  • Log in om te kunnen reageren

#1

ACMilan

    ACMilan


  • >100 berichten
  • 136 berichten
  • Ervaren gebruiker

Geplaatst op 30 juni 2008 - 12:02

Ik heb de minicursus over DNA gelezen en wat gelezen op wikipedia en ik wil even zien of ik alles doorheb.

Verschil RNA en DNA :
  • RNA is een enkelvoudige streng en DNA een dubbele streng (helix)
  • RNA heeft als basen G A U C en DNA heeft als basen G A C T
  • DNA is alleen een informatiedrager terwijl RNA een eiwitvormer is ?

Doel : eiwitten maken ?

Verloop :
Je hebt eerst DNA, dit ga je kopiŽren en zo verkrijg je even 2 aparte strengen, van deze strengen kan je ook een kopie maken en zo verkrijg je mRNA (transcriptie). mRNA alleen is niet voldoende, hieraan moeten nog bepaalde aminozuren aan gekoppeld worden, daarbij treedt rRNA op als katalysator. Vervolgens heb je ook tRNA die deze aminozuren met zich meebrengt. Op het mRNA heb je verschillende codons ( groepjes van 3 basen), je hebt ook nog een startcodon en een stopcodon, bij het stopcodon is het eiwit volledig en stopt het proces voor dat deeltje mRNA. De codons zijn een soort van bordjes met daarop welk aminozuur er op die plaats moet komen. Na het gehele proces verkrijgt men 1 eiwit.

Zit ik zo een beetje juist ?

Nog 2 vraagjes :

Eerste vraag

Bij een stopcodon stopt het proces (althans denk ik toch) dus dan begint het met een startcodon, maar moeten deze dan niet telkens na mekaar liggen ? Zo heb ik bijvoorbeeld :

UUUUAACACCGGAUGAUUCUUACAAUUUGAUGAACAGGUUGUAAA//An

startcodon : AUG
Dus dan begint het proces bij de eerste AUG, maar wat gebeurt er dan daarvoor en wat gebeurt er bij die 2e AUG ?

Tweede vraag

Je hebt van die tabellen (RNA codon tabellen) maar kan je daarmee ook afleiden hoe groot het gevormde eiwit zal zijn ? Want het eiwit van de code uit vraag 1 zou 1 aminozuur korter moeten zijn dan de volgende :

UUUUACACCGGAUGAUUCUUACAAUUAGAUGAACAGGUUGUAAA//An

(vetgedrukt zijn de veranderingen)

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Mrtn

    Mrtn


  • >1k berichten
  • 4220 berichten
  • VIP

Geplaatst op 30 juni 2008 - 12:19

Je zit een eind in de richting, maar een paar dingetjes zijn nog wel te verduidelijken zoals je al aangeeft:

Er zijn van zowel RNA als DNA meerdere configuratie mogelijk: er bestaat enkelstrengs en dubbelstrengs RNA en DNA. mRNA is echter altijd enkelstrengs en genomisch DNA dubbelstrengs.
Zowel DNA als (m)RNA is een informatiedrager, maar alleen mRNA wordt gebruikt als directe template om een eiwit van te bouwen. Zie het als een blauwdruk: je neemt het origineel niet mee de bouwput in. In plaats daarvan maak je een kopietje, waarbij het geen ramp is als er een koffievlek op komt.

Eiwitten maken in het kort:
DNA moet je ontwarren om onder de kopieermachine te kunnen leggen. Je maakt een kopietje van het gen in kwestie en dat kopietje noem je mRNA. Dit mRNA schop je de celkern uit, de bouwput in om een ribosoom te vertellen hoe hij aminozuren aan elkaar moet klussen om een eiwit te verkrijgen. Het mRNA wordt wel gebruikt, maar niet verbruikt bij die reactie en komt er dus net zo uit als het erin ging. Daarna wordt het afgebroken.


Dan de codons: vergeet niet dat je in tripletten moet denken. Je ziet hieronder dat die tweede AUG helemaal geen AUG is (maar twee keer een UGA:
UUU-UAA-CAC-CGG-AUG-AUU-CUU-ACA-AUU-UGA-UGA-ACA-GGU-UGU-AAA
Als je ergens een lettertje tussen zet, verschuif je het hele leesframe, waardoor je een compleet ander eiwit kan krijgen!
Voor dat eerste startcodon zitten regulerende sequenties. Die hebben geen directe invloed op het eiwit, maar kunnen wel invloed hebben op de productie ervan. Zie het maar als een vlaggetje waardoor het ribosoom het herkent en weet dat het een eiwit moet gaan maken.
Kom je hier weer wat verder mee?

Veranderd door Mrtn, 30 juni 2008 - 12:22

Of course, the theory of relativity only works if you're going west.
-Calvin-

#3

ACMilan

    ACMilan


  • >100 berichten
  • 136 berichten
  • Ervaren gebruiker

Geplaatst op 30 juni 2008 - 13:19

Je zit een eind in de richting, maar een paar dingetjes zijn nog wel te verduidelijken zoals je al aangeeft:

Er zijn van zowel RNA als DNA meerdere configuratie mogelijk: er bestaat enkelstrengs en dubbelstrengs RNA en DNA. mRNA is echter altijd enkelstrengs en genomisch DNA dubbelstrengs.
Zowel DNA als (m)RNA is een informatiedrager, maar alleen mRNA wordt gebruikt als directe template om een eiwit van te bouwen. Zie het als een blauwdruk: je neemt het origineel niet mee de bouwput in. In plaats daarvan maak je een kopietje, waarbij het geen ramp is als er een koffievlek op komt.

Eiwitten maken in het kort:
DNA moet je ontwarren om onder de kopieermachine te kunnen leggen. Je maakt een kopietje van het gen in kwestie en dat kopietje noem je mRNA. Dit mRNA schop je de celkern uit, de bouwput in om een ribosoom te vertellen hoe hij aminozuren aan elkaar moet klussen om een eiwit te verkrijgen. Het mRNA wordt wel gebruikt, maar niet verbruikt bij die reactie en komt er dus net zo uit als het erin ging. Daarna wordt het afgebroken.


Dan de codons: vergeet niet dat je in tripletten moet denken. Je ziet hieronder dat die tweede AUG helemaal geen AUG is (maar twee keer een UGA:
UUU-UAA-CAC-CGG-AUG-AUU-CUU-ACA-AUU-UGA-UGA-ACA-GGU-UGU-AAA
Als je ergens een lettertje tussen zet, verschuif je het hele leesframe, waardoor je een compleet ander eiwit kan krijgen!
Voor dat eerste startcodon zitten regulerende sequenties. Die hebben geen directe invloed op het eiwit, maar kunnen wel invloed hebben op de productie ervan. Zie het maar als een vlaggetje waardoor het ribosoom het herkent en weet dat het een eiwit moet gaan maken.
Kom je hier weer wat verder mee?


Veel duidelijker lijkt het me niet te kunnen, alles is duidelijk in je uitleg, bedankt !





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures