NCBI

Moderator: ArcherBarry

Forumregels
(Middelbare) school-achtige vragen naar het forum "Huiswerk en Practica" a.u.b.
Zie eerst de Huiswerkbijsluiter
Reageer
Berichten: 6

NCBI

hallo,

opdracht: primers zoeken voor exon van het ACT42A gen in D. melanogaster.

Wanneer ik dat gen opzoek op NCBI kom ik hier uit: https://www.ncbi.nlm.nih.gov/gene/35526
en krijg ik volgende FASTA: https://www.ncbi.nlm.nih.gov/nuccore/NT ... trand=true
of
>NT_033778.4:c6015689-6013910 Drosophila melanogaster chromosome 2R
CCACTTTAACTCGAAAAAGTAGGCGTCGGTCAATTCAATCTTAAAGCGTCTGTCATTGTGCTAAGTGTGT
GCAGCGGATAACTAGAAACTACTCCTACATATTTCCATAAAAGGTAAGACTCCTGCCCAACACTTTTTTT
TGTCTGTGCGGTCATTATTATTCCTTTCTGGAAGGGGTCGGTCCCGTCTGCGTTCTTTTTTACGTTAGCC
GCTGTCCTGTCTCCTTGTTTTTTTAGTGTACACATCCAGATTTCTTTTCTCTTGCAGATCCAAATAAAAT
TTCTACAAAATGTGTGACGAAGAGGTTGCAGCTTTAGTGGTCGACAACGGATCCGGCATGTGCAAAGCCG
GCTTTGCCGGTGATGACGCACCGCGTGCAGTTTTTCCTTCTATTGTCGGCCGTCCACGTCACCAGGGCGT
AATGGTAGGAATGGGACAAAAGGACTCTTATGTCGGCGATGAGGCACAGAGCAAACGTGGTATCCTTACC
CTGAAGTACCCCATTGAGCACGGTATCGTGACTAACTGGGACGACATGGAGAAGATCTGGCATCACACTT
TCTACAACGAGCTTCGTGTGGCCCCGGAGGAGCACCCCGTCTTGCTTACTGAGGCTCCTTTGAACCCCAA
GGCTAATCGCGAGAAGATGACTCAGATTATGTTTGAAACCTTCAACACTCCGGCCATGTATGTTGCCATC
CAGGCGGTGCTTTCTCTCTACGCCTCCGGCCGTACCACAGGTATCGTGTTGGACTCCGGCGACGGTGTCT
CCCATACTGTGCCCATTTATGAGGGCTACGCCCTGCCGCACGCCATCCTCCGTTTGGATCTAGCCGGTCG
CGATTTAACCGACTACCTGATGAAGATTCTTACTGAGCGCGGTTACAGCTTCACCACCACCGCCGAGCGT
GAAATTGTGCGCGACATCAAGGAGAAGCTGTGCTACGTGGCCTTGGACTTCGAGCAGGAGATGGCCACGG
CCGCTTCAAGCTCGTCCCTGGAGAAGTCGTACGAGTTGCCCGATGGACAGGTCATCACCATCGGAAATGA
GCGATTCCGTTGCCCCGAATCGCTGTTCCAGCCGTCGTTCCTCGGCATGGAGGCCTGTGGCATTCACGAG
ACCACCTACAACTCAATCATGAAGTGTGACGTCGACATCCGTAAGGATCTGTACGCCAACACTGTGCTGT
CCGGCGGCACCACCATGTACCCGGGAATCGCTGACCGCATGCAAAAGGAAATCACGGCGTTGGCTCCGTC
CACCATGAAGATTAAGATTGTTGCCCCGCCAGAACGCAAGTACTCTGTTTGGATCGGCGGCTCCATCCTG
GCTTCGCTGTCTACTTTCCAGCAGATGTGGATCTCGAAGCAAGAGTACGACGAGTCGGGCCCCTCCATTG
TTCACCGCAAGTGCTTCTAAGCAGTAGTCGGGCTGGGCGTGGTCGTTCCTCATCGAACACACCCATTGCA
GACAAAGGATGGGAGTCAAAAGTATTGGGCATGAGTACATTAATACCGGGAGCAGGCGCACAACACTTCC
GCTCCTTCAGAAGAATGCATTCCATTCACTTTTATACACAGTTGTACACGACGCATAAGCAAACCATATT
GTGTTCTATTCGAAATTCAAGTTCATATGCACATAAGCATTTATAAAACTGATTCATGTTTGGCATTTAC
ATTACTTCCATGCATTCCTACATATGTATTAAAAGCAAACTTACCATACCACTAAAATACTTGTAACCGC
TTCTTAATAATAAAGCGACGAAAAGAACTG

wat moet ik doen om de start-en-stopplaats van de exonen terug te vinden zodat ik mijn primers kan bepalen?
Mvg,
Wout

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.
Gebruikersavatar
Berichten: 8.532

Re: NCBI

Je bent dus op zoek naar de ORF. Hiervoor kan je zowel handmatig gaan zoeken naar een start en stop codon, in de drie mogelijke frame shifts. Eerst zoek je dus naar alle mogelijke start codons (ATG), en vertaal je alles wat downstream is naar je aminozuren. Zodoende kan je alle mogelijke ORFs vinden.

De meeste DNA analyse software (snapgene bijvoorbeeld) kan dit ook automatisch voor je doen. NCBI heeft hier ook een mogelijkheid voor met ORFfinder. https://www.ncbi.nlm.nih.gov/orffinder/

Je moet vervolgens gaan bepalen welk ORF correct is. Dit kan je doen door de aminozuur code weer terug te blasten. Maar meestal is het gewoon de langste ORF. In dit geval van nucleotide 290 tot 1420.

Annoteer dit vervolgens in Primer3plus en je zou de volgende primers kunnen vinden: http://www.bioinformatics.nl/cgi-bin/pr ... r3plus.cgi
Forward: GTTAGCCGCTGTCCTGTCTC
Reverse: TTGTCTGCAATGGGTGTGTT

Snap je de logica en welke primers bepaal jij?

Gebruikersavatar
Berichten: 8.532

Re: NCBI

Correctie, Act42A heeft 2 exons, Je zal dus eerst je mRNA moeten pakken.
https://www.ncbi.nlm.nih.gov/nuccore/NM ... port=fasta
Hier kan je vervolgens je ORF bepalen.
Dit ORF moet je vervolgens allignen met NT_033778.4. Zodoende kan je de intron-exon boundaries exact bepalen. Primers kan je vervolgens bijvoorbeeld met Primer3plus bepalen.

Reageer