Springen naar inhoud

Hoe kan men de DNA-code ontcijferen?


  • Log in om te kunnen reageren

#1

Myheroh

    Myheroh


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 08 september 2005 - 20:00

Mijn vraag is heel simpel :

Hoe kan men de DNA code allemaal ontcijferen? en hoe rap gaat dit ongeveer? Zitten er ook soms fouten op?

En kan men DNA ook herconstrueren?

Dit forum kan gratis blijven vanwege banners als deze. Door te registeren zal de onderstaande banner overigens verdwijnen.

#2

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8252 berichten
  • VIP

Geplaatst op 09 september 2005 - 10:06

wat bedoel je met ontcijferen? de transcriptie en translatie van DNA naar eiwit? Of bedoel je het bepalen van de DNA sequentie?

Wat bedoel je precies met DNA herconstueren?

Je stelt alemaal vrij vage vragen. Daar is dan ook niet een duidelijk antwoord op te geven.
"Meep meep meep." Beaker

#3

Dino

    Dino


  • >250 berichten
  • 740 berichten
  • Ervaren gebruiker

Geplaatst op 09 september 2005 - 16:02

1)sequeneren, dit is het ontcijferen van de ACTG tjes van de DNA streng, ik gok dat je een paar maanden nodig hebt tot meer dan een jaar om 1 DNA streng te lezen (want dat is sequeneren) achterhalen wat de volgorde is van de basen.

2)dan moet je zien te ontrafelen wat die lettertjes betekenen
dusdanmoetjezienteachterhalenwelkeletterssameneenwoordvormenenwaareenzinbegint
wat een ongelooflijk moeilijke arbeid is, en persoonlijk weet ik niet hoelang dat duurt ik gok zeker enkele jaren pak 6 jaar voor een relatief korte streng.

3)reconstueren als in een basepaar veranderen door een ander dat denk ik niet dat kan.

reconstueren als in een stukje bij zetten jup dat kan.

xd

#4

Myheroh

    Myheroh


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 09 september 2005 - 16:04

dus als ze alles bv in de computer gestoken hebben de volgorde enz..
en deze gegevens weer toepassen om de DNA te herconstueren kunnen ze dus op deze manier ook een cloon maken he? is dit al gedaan?

#5

sdekivit

    sdekivit


  • >250 berichten
  • 704 berichten
  • Ervaren gebruiker

Geplaatst op 09 september 2005 - 18:49

DNA-sequencing werd vroeger gedaan via de dideoxymethode van Sanger en dan de fragementen te schijden op een gel via electroforese. Tegenwwordig zijn er veel geavanceerdere methoden zoals fluorescerentiemeting enz.

#6

Sophia?

    Sophia?


  • >250 berichten
  • 323 berichten
  • Ervaren gebruiker

Geplaatst op 10 september 2005 - 03:05

De duur van het bepalen van een DNA sequentie hangt helemaal af van de lengte van de keten en de gebruikte techniek. Normaal in een lab kunnen eenvoudig enkele duizenden basenparen overnacht "gesequenced" worden, met een kleine kans dat hierin fouten worden gemaakt. Het sequencen van een heel genoom is een verhaal apart, omdat het ten eerste om gigantische hoeveelheden gaat en het ten weede een hoop uitmaakt of je al een vermoeden hebt van wat de sequentie moet zijn (ivm maken van primers voor de PCR-kenners onder ons). Dit kan dus fors wat tijd in beslag nemen (rustig maandenlang).
Afhankelijk van de gevolgde techniek is de kans op fouten bij sequencen zeer klein tot ultra-klein; de technieken zijn zeer verfijnd.
Het reproduceren van DNA-ketens op basis van informatie op papier is inmiddels zeer normaal en gebeurt vele malen per dag in labs over de hele wereld; het betreft hier echte zeer korte stukjes DNA (15 - 50 baseparen lang), die als zogenaamde primers in PCR-reacties worden gebruikt. Naarmate de te produceren keten langer is, zal de kans op fouten toenemen en ketens van meer dan 50 baseparen worden over het algemeen dan ook niet uit het niets gegenereerd. Meestal wil je toch een bestaand gen hebben, en dan kun je dit net zo goed uit een dier of plant halen, dat is veel betrouwbaarder, sneller en goedkoper. Als je hier dan een kleine verandering in wilt aanbrengen, kan dat met de eerdergenoemde PCR reactie.
Het verwijderen, toevoegen, of aanpassen van DNA in een levend wezen is een tijdrovende en ingewikkelde klus, die ook weer per diersoort makkelijker of moeilijker is. Sowieso is een verandering van DNA pas merkbaar in het nageslacht van het organisme waarin je hebt "ge-edit" en niet in dat dier zelf.

groet

#7

Magda

    Magda


  • >25 berichten
  • 45 berichten
  • Gebruiker

Geplaatst op 10 september 2005 - 11:13

dus als ze alles bv in de computer gestoken hebben de volgorde enz..
en deze gegevens weer toepassen om de DNA te herconstueren kunnen ze dus op deze manier ook een cloon maken he? is dit al gedaan?


Neen, op deze manier kan je niet te werk gaan. Een cloon maken vanaf de sequentie volgorde vanuit de computer zal niet lukken. We kunnen nu in een reactiebuisje een streng maken van 60-100 baseparen en niet langer. Willen we langere stukken (tot 10.000 bp) maken dan kan dat met PCR (Polymerase Chain Reaction) en dan hebben we een intact exemplaar van het DNA stuk nodig als template. Maar dit is allemaal niks in vergelijking met een heel chromosoom....... De enige manier om aan complete chromosomen te komen is om ze uit levende cellen te halen en zo wordt er dan ook gecloont. (dit is wel een erg simpele voorstelling van clonen, maar daar gaat dit topic niet over)

Het zou trouwens wel leuk zijn als je vanaf een sequentievolgorde uit de computer zou kunnen clonen: er is vast genoeg dodo DNA te vinden maar dit is allemaal in kleine stukjes gebroken. Maar als je alle stukjes in de computer zou kunnen reconstueren tot het complete DNA en dit zou kunnen synthetiseren dan kan je in principe de dodo weer tot leven roepen. Persoonlijk denk ik dat dat in de toekomst ook niet gaat werken..... de dodo zal dus, naar mijn mening, nooit meer op onze aarde rondlopen

#8

peterA

    peterA


  • >250 berichten
  • 672 berichten
  • Ervaren gebruiker

Geplaatst op 10 september 2005 - 11:28

dus als ze alles bv in de computer gestoken hebben de volgorde enz..
en deze gegevens weer toepassen om de DNA te herconstueren kunnen ze dus op deze manier ook een cloon maken he? is dit al gedaan?


Neen, op deze manier kan je niet te werk gaan. Een cloon maken vanaf de sequentie volgorde vanuit de computer zal niet lukken. We kunnen nu in een reactiebuisje een streng maken van 60-100 baseparen en niet langer. Willen we langere stukken (tot 10.000 bp) maken dan kan dat met PCR (Polymerase Chain Reaction) en dan hebben we een intact exemplaar van het DNA stuk nodig als template. Maar dit is allemaal niks in vergelijking met een heel chromosoom....... De enige manier om aan complete chromosomen te komen is om ze uit levende cellen te halen en zo wordt er dan ook gecloont. (dit is wel een erg simpele voorstelling van clonen, maar daar gaat dit topic niet over)

Het zou trouwens wel leuk zijn als je vanaf een sequentievolgorde uit de computer zou kunnen clonen: er is vast genoeg dodo DNA te vinden maar dit is allemaal in kleine stukjes gebroken. Maar als je alle stukjes in de computer zou kunnen reconstueren tot het complete DNA en dit zou kunnen synthetiseren dan kan je in principe de dodo weer tot leven roepen. Persoonlijk denk ik dat dat in de toekomst ook niet gaat werken..... de dodo zal dus, naar mijn mening, nooit meer op onze aarde rondlopen


Zijn,zelfs theoretisch,een mama en een papa dodo niet onontbeerlijk bij klonen.
Die "gecodeerde cellen" hebben toch een "systeem" nodig om zich tot dodo te "organiseren"
of zie ik dat verkeerd
huh?

#9

Cassanne

    Cassanne


  • >1k berichten
  • 1349 berichten
  • VIP

Geplaatst op 11 september 2005 - 13:29

Je zal een struisvogel ofzoiets als draagmoeder moeten gebruiken. Hadden ze in China niet honden (?) als draagmoeder voor pandabeertjes? De kans op afstoting van het embryo is uiteraard wel groot, dus het zal heel wat eieren kosten voor je 1 dodo hebt. (Die je daarna opnieuw zal moeten klonen, want in zijn eentje legt ook een dodo geen ei.) Het lijkt mij persoonlijk niet zinvol, als het al zou kunnen (niet dus).
Give a man a fire, and he's warm for a day. Set him on fire, and he's warm for the rest of his life!

#10

Sophia?

    Sophia?


  • >250 berichten
  • 323 berichten
  • Ervaren gebruiker

Geplaatst op 11 september 2005 - 16:35

Hoezo zou je sowieso uitgestorven diersoorten willen terughalen? Je kan ze niet weer terug in de natuur zetten en voor gedragsonderzoek zijn de meeste ook weinig interessant (vooral de dodo...). Als attractie in een dierentuin is misschien nog wel aardig?

#11

Myheroh

    Myheroh


  • 0 - 25 berichten
  • 21 berichten
  • Gebruiker

Geplaatst op 14 september 2005 - 20:22

Hoezo zou je sowieso uitgestorven diersoorten willen terughalen? Je kan ze niet weer terug in de natuur zetten en voor gedragsonderzoek zijn de meeste ook weinig interessant (vooral de dodo...). Als attractie in een dierentuin is misschien nog wel aardig?


Je kan ze wel terug in de natuur zetten.
Gedragsonderzoek is zeker wel interresant (mss van dodo niet zo echt, maar er zijn meer uitgestorven soorten he)
kun je trouwens Dna uit beenderen halen?[/code]

#12

Sophia?

    Sophia?


  • >250 berichten
  • 323 berichten
  • Ervaren gebruiker

Geplaatst op 14 september 2005 - 20:43

Je kan ze wel terug in de natuur zetten.


Ja feitelijk kan dat dan wel natuurlijk, maar ethisch gezien is dit niet mogelijk. Ten eerste zijn dieren niet voor niets uitgestorven en zullen het dus snel weer afleggen tegen bestaande soorten (zielig voor het nieuwe beestje). Een andere mogelijkheid is dat bestaande soorten zullen worden weggeconcurreerd en op hun beurt zullen uitsterven (zielig voor de oude beestjes, plus, je bent nog steeds evenver van huis).

Gedragsonderzoek is zeker wel interresant (mss van dodo niet zo echt, maar er zijn meer uitgestorven soorten he)


Gedragsonderzoek is voornamelijk interessant als je dieren in hun habitat kunt bekijken, en die habitat bestaat niet meer, wat het onderzoek minder interessant maakt. Veel dieren zullen daarbij, lijkt mij, gedrag vertonen wat vrijwel hetzelfde is als van huidige soorten. Alleen wat betreft uitgestorven evolutionaire takken (zoals dinosauriers) zou het nog wel aardig zijn om dit eens te bezien. Maar al met al denk ik niet dat je iemand zo gek zult krijgen om zo'n Jurassic Park project te financieren :shock:


kun je trouwens Dna uit beenderen halen?


Ja.

groet

#13

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8252 berichten
  • VIP

Geplaatst op 14 september 2005 - 20:44

Elk lichaamseigen weefsel bevat in meer of mindere mate DNA. Of dit dan nog geschikt is voor een sequencing of PCR'etje is dan nog maar de vraag.
"Meep meep meep." Beaker

#14

Sophia?

    Sophia?


  • >250 berichten
  • 323 berichten
  • Ervaren gebruiker

Geplaatst op 14 september 2005 - 20:45

kun je trouwens Dna uit beenderen halen?


(aanvulling) Maar niet uit fossielen (dat zijn geen beenderen meer). Je moet deels intact weefsel hebben om DNA te isoleren. Volgens mij is er recentelijk DNA uit T-Rex overblijfselen gehaald (stukjes spieraanhechting die nog aan botten zaten ofzo...).

groet

#15

Wouter_Masselink

    Wouter_Masselink


  • >5k berichten
  • 8252 berichten
  • VIP

Geplaatst op 14 september 2005 - 20:56

Bron?

Als dit zo is dan zal het DNA zover zijn gedegenereerd dat er niets meer van over is.

Bij normale sequencing van het DNA neemt men heel veel stukken van ongeveer 500 bp. Deze worden door een computer afgelezen en nadat ze zijn afgelezen worden ze allemaal onder elkaar gelegd. Waar het DNA overeenkomsten vertoond kan er worden aangenomen dat het bij elkaar hoorde. Dit is in woorden vrij moeilijk uit te leggen. Daarom hier een voorbeeldje:

AAAACTGTTGCATGGTTT

GTTGCATGGTTTAAACGT

Als je goed kijkt kan je zien dat het laatste stuk van het eerste gedeelte en het eerste stuk van het tweede gedeelte met elkaar overeen komen. Men kan op deze plaats het DNA als het ware aan elkaar plakken waardoor men uiteindelijk de volgende sequentie krijgt:

AAAACTGTTGCATGGTTTAAACGT

Dit word voor elk stukje gedaan. Dit is mogelijk doordat er niet 1 streng maar meerdere strengen van hetzelfde DNA worden gebruikt. Deze worden allemaal in willekeurige stukken geknipt. Hierdoor zal er altijd een gedeeltelijke overlapping optreden en kunnen de stukken met elkaar worden verbonden.
"Meep meep meep." Beaker





0 gebruiker(s) lezen dit onderwerp

0 leden, 0 bezoekers, 0 anonieme gebruikers

Ook adverteren op onze website? Lees hier meer!

Gesponsorde vacatures

Vacatures